Stem-loop sequence aly-MIR397a

AccessionMI0014583 (change log)
DescriptionArabidopsis lyrata miR397a stem-loop
Gene family MIPF0000120; MIR397
Stem-loop
          uu   -au      c                a     u   c    uu       g 
5' uccugga  uga   gaacau auugagugcagcguug uguaa uuc uuuu  uuucauu u
   |||||||  |||   |||||| |||||||||||||||| ||||| ||| ||||  |||||||  
3' aggacuu  auu   uuugua uaacucgcguugcggc acauu aag aaaa  aagguaa u
          uu   cuu      u                c     u   -    uu       g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 22804022-22804147 [+]
intergenic
Database links

Mature sequence aly-miR397a-5p

Accession MIMAT0017561
Previous IDsaly-miR397a
Sequence

20 - 

ucauugagugcagcguugaug

 - 40

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR397a-3p

Accession MIMAT0017562
Previous IDsaly-miR397a*
Sequence

88 - 

ccggcguugcgcucaauuaug

 - 108

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2