Stem-loop sequence aly-MIR397b

AccessionMI0014584 (change log)
DescriptionArabidopsis lyrata miR397b stem-loop
Gene family MIPF0000120; MIR397
Stem-loop
         --uuu   u      c                     aguuuac        uuc    g 
5' ccuggg     gaa aaacau auugagugcagcguugaugua       uuauuuua   cauu u
   ||||||     ||| |||||| |||||||||||||||||||||       ||||||||   ||||  
3' ggacuu     cuu uuugua uaacuuacguugcgacuacau       aguaaaau   guaa u
         uuaau   -      u                     aagacau        uaa    g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 14978335-14978465 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR397b
aly-MIR397bGL348719.1: 14978335-14978465 [-]
aly-MIR857GL348719.1: 14977807-14978279 [-]
Database links

Mature sequence aly-miR397b-5p

Accession MIMAT0017563
Previous IDsaly-miR397b
Sequence

19 - 

ucauugagugcagcguugaug

 - 39

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR397b-3p

Accession MIMAT0017564
Previous IDsaly-miR397b*
Sequence

94 - 

ucagcguugcauucaauuaug

 - 114

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2