Stem-loop sequence aly-MIR398b

AccessionMI0014586 (change log)
DescriptionArabidopsis lyrata miR398b stem-loop
Gene family MIPF0000107; MIR398
Stem-loop
       uauuu  -aa     ---u   u    a     u    a              uaaucaacggcug          
5' gaua     ug   gguag    gga cucg caggg ugau ugaggacacaugug             uaaugacgc 
   ||||     ||   |||||    ||| |||| ||||| |||| ||||||||||||||             |||||||| c
3' cuau     ac   ccauc    ucu gagu guccc acug acucuuguguacau             guuacugca 
       -uucu  cag     ucuu   c    c     c    g              ------------u          
Get sequence
Deep sequencing
12 reads, 400 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 5876498-5876639 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR398b
aly-MIR398bGL348718.1: 5876498-5876639 [+]
aly-MIR398cGL348718.1: 5880311-5880442 [+]
Database links

Mature sequence aly-miR398b-5p

Accession MIMAT0017567
Previous IDsaly-miR398b*
Sequence

31 - 

ggguugauaugaggacacaug

 - 51

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR398b-3p

Accession MIMAT0017568
Previous IDsaly-miR398b
Sequence

91 - 

uguguucucaggucaccccug

 - 111

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2