Stem-loop sequence aly-MIR399a

AccessionMI0014588 (change log)
DescriptionArabidopsis lyrata miR399a stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
        ga    gaucaaag ug   augu     a     a       a       ga   ca         -u uu     cu 
5' caugu  gaug        g  gaa    auuac gggua gaucucu uuggcag  aac  uuacuuaga  c  ugcau  c
   |||||  ||||        |  |||    ||||| ||||| ||||||| |||||||  |||  |||||||||  |  |||||   
3' guaua  uuau        c  cuu    uaaug cccgu uuagagg aaccguc  uug  agugaauuu  g  acgua  u
        -g    -auaacca gu   --cu     g     -       a       uc   --         uc uu     uu 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 12890901-12891062 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR399a
aly-MIR399gGL348713.1: 12882529-12882685 [-]
aly-MIR399hGL348713.1: 12884715-12884820 [+]
aly-MIR399iGL348713.1: 12888628-12888754 [-]
aly-MIR399aGL348713.1: 12890901-12891062 [+]
Database links

Mature sequence aly-miR399a-5p

Accession MIMAT0017571
Previous IDsaly-miR399a*
Sequence

36 - 

ggguaagaucucuauuggcagg

 - 57

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399a-3p

Accession MIMAT0017572
Previous IDsaly-miR399a
Sequence

113 - 

ugccaaaggagauuugcccgg

 - 133

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2