Stem-loop sequence aly-MIR399b

AccessionMI0014589 (change log)
DescriptionArabidopsis lyrata miR399b stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   --------caug      -c  a            c      a          cuuuauuuccaaauauacacauacaua 
5'             uaagcu  ac aguuuuagggcg cucucc uuggcagguc                           u
               ||||||  || |||||||||||| |||||| ||||||||||                           a
3'             auucga  ug ucaaagucccgu gagagg aaccguccag                           u
   guacacaaauua      cu  g            u      a          uauauauuuagcuuuaaaagauauaag 
Get sequence
Deep sequencing
8 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 1307899-1308052 [+]
intergenic
Database links

Mature sequence aly-miR399b-5p

Accession MIMAT0017573
Previous IDsaly-miR399b*
Sequence

22 - 

gggcgccucuccauuggcagg

 - 42

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399b-3p

Accession MIMAT0017574
Previous IDsaly-miR399b
Sequence

106 - 

ugccaaaggagaguugcccug

 - 126

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2