Stem-loop sequence aly-MIR399d

AccessionMI0014591 (change log)
DescriptionArabidopsis lyrata miR399d stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
          -------aa       u      a u        a     a       -u   --     cuaga 
5' gagagau         uguaugg uggauu c gggcgaau cuccu uggcaga  agc  uuugc     u
   |||||||         ||||||| |||||| | |||||||| ||||| |||||||  |||  |||||      
3' cuuucua         acguacc acuuaa g cccguuua gagga accgucu  ucg  aaacg     a
          cauaacaaa       u      c c        -     a       cu   ua     aacgu 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 16217498-16217632 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR399d
aly-MIR399fGL348716.1: 16219612-16219778 [+]
aly-MIR399eGL348716.1: 16218063-16218253 [+]
aly-MIR399dGL348716.1: 16217498-16217632 [-]
Database links

Mature sequence aly-miR399d-5p

Accession MIMAT0017577
Previous IDsaly-miR399d*
Sequence

27 - 

gggcgaauacuccuauggcaga

 - 48

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399d-3p

Accession MIMAT0017578
Previous IDsaly-miR399d
Sequence

84 - 

ugccaaaggagauuugccccg

 - 104

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2