Stem-loop sequence aly-MIR399f

AccessionMI0014593 (change log)
DescriptionArabidopsis lyrata miR399f stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
        a    ca     --aa       auac           a    a  a        --aa  u     -uu    cu       
5' augaa gaua  uagag    ggugcaa    auuacagggca gauc cc uuggcaga    uc auuac   cauu  ugcaua 
   ||||| ||||  |||||    |||||||    ||||||||||| |||| || ||||||||    || |||||   ||||  ||||| a
3' uacuu cuau  auuuu    ccgcguu    uaaugucccgu uuag gg aaccgucu    ag uggug   guaa  acguau 
        -    ag     guaa       cucu           -    a  a        cucg  -     uuu    uu       
Get sequence
Deep sequencing
6 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 16219612-16219778 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR399f
aly-MIR399dGL348716.1: 16217498-16217632 [-]
aly-MIR399eGL348716.1: 16218063-16218253 [+]
aly-MIR399fGL348716.1: 16219612-16219778 [+]
Database links

Mature sequence aly-miR399f-5p

Accession MIMAT0017581
Previous IDsaly-miR399f*
Sequence

37 - 

gggcaagaucaccauuggcaga

 - 58

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399f-3p

Accession MIMAT0017582
Previous IDsaly-miR399f
Sequence

112 - 

ugccaaaggagauuugcccug

 - 132

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2