Stem-loop sequence aly-MIR403a

AccessionMI0014595 (change log)
DescriptionArabidopsis lyrata miR403a stem-loop
Gene family MIPF0000290; MIR403
Stem-loop
         u  u     au    u        c             g uuau     a     uu 
5' gaagag cg auuac  guuu gugcguga ucuaauuuaacag c    guuug gauuu  u
   |||||| || |||||  |||| |||||||| ||||||||||||| |    ||||| |||||  u
3' cuuuuc gu uaaug  caaa cacgcacu agauuagguuguc g    uaggc cuaaa  g
         u  c     cu    -        u             - -uuu     -     ca 
Get sequence
Deep sequencing
65 reads, 1.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 22991768-22991892 [+]
intergenic
Database links

Mature sequence aly-miR403a-5p

Accession MIMAT0017585
Previous IDsaly-miR403*
Sequence

17 - 

uguuuugugcgugacucuaauu

 - 38

Get sequence
Deep sequencing41 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR403a-3p

Accession MIMAT0017586
Previous IDsaly-miR403
Sequence

91 - 

uuagauucacgcacaaacucg

 - 111

Get sequence
Deep sequencing24 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2