Stem-loop sequence aly-MIR771

AccessionMI0014598 (change log)
DescriptionArabidopsis lyrata miR771 stem-loop
Gene family MIPF0001122; MIR771
Stem-loop
       c        c    u  c        - a   a   cagua   u  au 
5' auuc acaugagc ucug gg agcccucg c aug ucu     gag gc  g
   |||| |||||||| |||| || |||||||| | ||| |||     ||| ||  c
3' uaag uguacuug agac cc ucgggagu g ugc aga     uuc ug  c
       c        u    u  -        a a   -   -aaug   u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 16404124-16404228 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR771
aly-MIR851GL348717.1: 16404386-16404469 [-]
aly-MIR771GL348717.1: 16404124-16404228 [-]
Database links

Mature sequence aly-miR771-5p

Accession MIMAT0017591
Previous IDsaly-miR771
Sequence

9 - 

ugagccucuguggcagcccuc

 - 29

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR771-3p

Accession MIMAT0017592
Previous IDsaly-miR771*
Sequence

80 - 

gggcuccucagauguucaug

 - 99

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2