Stem-loop sequence aly-MIR774a

AccessionMI0014599 (change log)
Previous IDsaly-MIR774
DescriptionArabidopsis lyrata miR774a stem-loop
Gene family MIPF0001101; MIR774
Stem-loop
      uuguucauuu     cau   c    c a             u    c   a   uu    c   u 
5' gcg          ggauu   auu gaga g agauaugggugac aaua uua gau  uggu aau u
   |||          |||||   ||| |||| | ||||||||||||| |||| ||| |||  |||| |||  
3' ugc          ucuaa   uaa cucu c ucuauacccauug uuau aau cua  acca uua a
      -ugaaaauuc     -uu   c    a c             u    u   -   --    -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 3372430-3372563 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR774a
aly-MIR859GL348714.1: 3372640-3372797 [-]
aly-MIR774aGL348714.1: 3372430-3372563 [-]
aly-MIR774bGL348714.1: 3372279-3372385 [-]
Database links

Mature sequence aly-miR774a-5p.1

Accession MIMAT0017593
Previous IDsaly-miR774.1
Sequence

25 - 

cgagacgaagauaugggugac

 - 45

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR774a-5p.2

Accession MIMAT0017594
Previous IDsaly-miR774.2
Sequence

33 - 

agauaugggugacuaauacuu

 - 53

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR774a-3p.2

Accession MIMAT0017595
Previous IDsaly-miR774.2*
Sequence

86 - 

uuauuuguuacccauaucucc

 - 106

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR774a-3p.1

Accession MIMAT0017596
Previous IDsaly-miR774.1*
Sequence

94 - 

uacccauaucuccaucuccaa

 - 114

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2