Stem-loop sequence aly-MIR822

AccessionMI0014601 (change log)
DescriptionArabidopsis lyrata miR822 stem-loop
Gene family MIPF0001199; MIR822
Stem-loop
   --aug           c             c ag                  c   u  c            uc    c        u      -    gaua      uguac             uuguuaacgucauaaaauuua 
5'      gggauguaacg auguuguuuucug g  gagcauuuguacauguuu aug ag augaaaucacau  caua augaauag aauuac cuua    ggacau     ugcuugaaaaaac                     u
        ||||||||||| ||||||||||||| |  |||||||||||||||||| ||| || ||||||||||||  |||| |||||||| |||||| ||||    ||||||     |||||||||||||                      
3'      cccuacauugc uacaacaaaggac c  uucguaaacguguguaaa uac uc uacuuuagugua  guau uacuuauu uuaaug gagu    ccugug     acgaacuuuuuug                     g
   aucua           a             a cu                  a   u  c            ca    a        u      a    ---a      ----u             ugaaaaauauccacaaaagua 
Get sequence
Deep sequencing
20 reads, 300 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 1060462-1060749 [-]
intergenic
Database links

Mature sequence aly-miR822-5p

Accession MIMAT0017599
Previous IDsaly-miR822
Sequence

7 - 

auguaacgcauguuguuuucu

 - 27

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR822-3p

Accession MIMAT0017600
Previous IDsaly-miR822*
Sequence

262 - 

gaaacaacauacguuacaucc

 - 282

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2