Stem-loop sequence aly-MIR824

AccessionMI0014603 (change log)
DescriptionArabidopsis lyrata miR824 stem-loop
Gene family MIPF0000442; MIR824
Stem-loop
      ug    u               u             uuuuguuu     aauacccaccaaucucuaaguuuguaagaaguauuaugcucaauuaaggaaaauagcuaguucaacuuaccacacuacccuuuuacaaacuauccuauauguuagaugcuagcauggcguaauuuuguguucucauucugcagcaggguuaguuucuuguguaccucuagauauuuauucucuugcugcguaggguucccaagcugccaaaaacuuuucaaaauuagagaucuguuccccacuaacccccauccaauaaggaaggucuaccugu 
5' agu  ucuc caugucuagaccauu gugagaagggagu        gcacc                                                                                                                                                                                                                                                                                  a
   |||  |||| ||||||||||||||| |||||||||||||        |||||                                                                                                                                                                                                                                                                                   
3' uca  ggag guguagaucugguag uacucuucccuua        ugugg                                                                                                                                                                                                                                                                                  u
      gu    c               c             uauugguu     aggggugagggguaaaaauaaauaauccuuuggaucacauucuauguuuaagaaccgaugguacugguuccacauuuacuaaaauauacuaaagcucuuagccgaaccugaucaauauuauguuuauuuuuucaauagacacguuguagaccuuuucaguacuuacuugaauuagcugaaugaagauauggauugaagacuuccuagucuaaaguaccccauugauuuugucauuuugguucugcgcucgugucgaaauuaucgacacucgaug 
Get sequence
Deep sequencing
328 reads, 1.01e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 7604265-7604918 [-]
intergenic
Database links

Mature sequence aly-miR824-5p

Accession MIMAT0017603
Previous IDsaly-miR824
Sequence

17 - 

uagaccauuugugagaaggga

 - 37

Get sequence
Deep sequencing218 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR824-3p

Accession MIMAT0017604
Previous IDsaly-miR824*
Sequence

620 - 

ccuucucaucgauggucuaga

 - 640

Get sequence
Deep sequencing110 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2