Stem-loop sequence aly-MIR825

AccessionMI0014604 (change log)
DescriptionArabidopsis lyrata miR825 stem-loop
Gene family MIPF0001178; MIR825
Stem-loop
      auaa  ca u   ug ---uuc        c     a     ag     a           aa   --    ua a 
5' ggu    uu  c gau  a      caucaacu guuca gcacc  cucga gaagcguagcu  uuu  aucu  g a
   |||    ||  | |||  |      |||||||| ||||| |||||  ||||| |||||||||||  |||  ||||  | a
3' cca    aa  g cua  u      guaguuga caagu cgugg  gagcu cuucgcaucga  aag  uagg  c a
      ---g  ac u   gu uuauac        a     a     aa     -           aa   uu    ua u 
Get sequence
Deep sequencing
2685 reads, 8.61e+04 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 6095652-6095803 [+]
intergenic
Database links

Mature sequence aly-miR825-5p

Accession MIMAT0017605
Previous IDsaly-miR825*
Sequence

34 - 

ucaagcaccagcucgaagaagc

 - 55

Get sequence
Deep sequencing853 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR825-3p

Accession MIMAT0017606
Previous IDsaly-miR825
Sequence

101 - 

uucucgagaaggugcaugaac

 - 121

Get sequence
Deep sequencing1821 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2