Stem-loop sequence aly-MIR828

AccessionMI0014606 (change log)
DescriptionArabidopsis lyrata miR828 stem-loop
Gene family MIPF0000544; MIR828
Stem-loop
   -cau         -  caaaa      aaaucucc        u ua     u                 uc    --uaa     g gu --        a 
5'     ggacaaagu ca     gugaua        uuccacuu c  auguu cuugcuuaaaugaguau  caug     aaaau a  c  acucacuc u
       ||||||||| ||     ||||||        |||||||| |  ||||| |||||||||||||||||  ||||     ||||| |  |  ||||||||  
3'     ucuguuuua gu     uacuau        aaggugag g  uguaa gaacgaguuuacucgua  guac     uuuug u  g  uggguggg a
   guuu         a  -auug      gauuuauc        u uc     c                 ga    uucuc     g ug gu        u 
Get sequence
Deep sequencing
2 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 6065263-6065461 [-]
intergenic
Database links

Mature sequence aly-miR828-5p

Accession MIMAT0017609
Previous IDsaly-miR828
Sequence

51 - 

ucuugcuuaaaugaguauucca

 - 72

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR828-3p

Accession MIMAT0017610
Previous IDsaly-miR828*
Sequence

129 - 

agaugcucauuugagcaagcaa

 - 150

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2