Stem-loop sequence aly-MIR839

AccessionMI0014613 (change log)
DescriptionArabidopsis lyrata miR839 stem-loop
Gene family MIPF0001143; MIR839
Stem-loop
        uuc    -  acua       a     ---cac               cuc         auc                -            u        gu         a                       a  c  c      
5' caacu   guua ca    ucauucg gugag      aaagaguagcauaag   uccuuugac   uucaccaaccucucau cguucccuucuc guaauaac  cguuuugca aacugcaaugguccugagccgau ag cu uaaug 
   |||||   |||| ||    ||||||| |||||      |||||||||||||||   |||||||||   |||||||||||||||| |||||||||||| ||||||||  ||||||||| ||||||||||||||||||||||| || || |||| a
3' guuga   caau gu    agugagu uacuc      uuucucaucguauuc   gggaaacug   aagugguuggagagua gcaagggaagag cguuauug  gcaaaacgu uuggcguuaccaggacucggcua uc ga auuaa 
        uac    a  ---g       a     uuuuuu               -uc         caa                c            c        ug         g                       c  a  u      
Get sequence
Deep sequencing
18 reads, 400 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 12500788-12501085 [-]
intergenic
Database links

Mature sequence aly-miR839-5p

Accession MIMAT0017623
Previous IDsaly-miR839
Sequence

67 - 

caccaaccucucaucguuccc

 - 87

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR839-3p

Accession MIMAT0017624
Previous IDsaly-miR839*
Sequence

213 - 

gaacgcaugagagguuggugaa

 - 234

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2