Stem-loop sequence aly-MIR840

AccessionMI0014614 (change log)
DescriptionArabidopsis lyrata miR840 stem-loop
Gene family MIPF0001129; MIR840
Stem-loop
       c    c       g     -     -a     uc   -   a   c   a          c     a          u        g   c  c           gg   ua  c  uua 
5' gauu gggg ucguaaa caggu gauuc  ccaau  agg uuu cau cgc guguggaaga acuaa ggaccuaaac aacaaaga aaa ag ucauugugcgg  uau  ca uc   a
   |||| |||| ||||||| ||||| |||||  |||||  ||| ||| ||| ||| |||||||||| ||||| |||||||||| |||||||| ||| || |||||||||||  |||  || ||   u
3' cuaa ccuu agcauuu guuca cuaag  gguug  ucc aaa gua gcg cauaucuucu ugauu ccuggauuug uuguuucu uuu uc aguagcacgcc  aua  gu ag   g
       a    u       g     a     ca     ua   u   -   a   c          u     c          u        a   c  u           ua   gc  a  ucu 
Get sequence
Deep sequencing
69 reads, 1.7e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 995511-995757 [-]
intergenic
Database links

Mature sequence aly-miR840-5p

Accession MIMAT0017625
Previous IDsaly-miR840
Sequence

61 - 

acacuaaaggaccuaaacuaac

 - 82

Get sequence
Deep sequencing20 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR840-3p

Accession MIMAT0017626
Previous IDsaly-miR840*
Sequence

166 - 

uuguuuaggucccuuaguuucu

 - 187

Get sequence
Deep sequencing42 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2