Stem-loop sequence aly-MIR842

AccessionMI0014615 (change log)
DescriptionArabidopsis lyrata miR842 stem-loop
Gene family MIPF0001158; MIR842
Stem-loop
   auaaacuauugcaaaa        cac   c             c               gca  aa   au   - ga 
5'                 agagagac   aag gggaugauggauc gaccaugaugguguu   ga  cuu  gua c  g
                   ||||||||   ||| ||||||||||||| |||||||||||||||   ||  |||  ||| |   
3'                 uuuuuuug   uuc cccuacugccuag cugguacuaccacaa   cu  gga  uau g  g
   uauaggaacaacugga        -ua   a             a               -ag  gg   cc   u au 
Get sequence
Deep sequencing
11 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 2587536-2587692 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR842
aly-MIR842GL348714.1: 2587536-2587692 [-]
aly-MIR846GL348714.1: 2586985-2587456 [-]
Database links

Mature sequence aly-miR842-5p

Accession MIMAT0017627
Previous IDsaly-miR842*
Sequence

35 - 

augauggauccgaccaugaug

 - 55

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR842-3p

Accession MIMAT0017628
Previous IDsaly-miR842
Sequence

106 - 

ucauggucagauccgucaucc

 - 126

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2