Stem-loop sequence aly-MIR845a

AccessionMI0014617 (change log)
DescriptionArabidopsis lyrata miR845a stem-loop
Gene family MIPF0000369; MIR845_1
Stem-loop
   ucaaua  ucc    cucg        ca                    a   cu  g 
5'       gu   aucg    guuuccau  cgucgauuggugucagagcc cgc  au a
         ||   ||||    ||||||||  |||||||||||||||||||| |||  || a
3'       cg   uagc    caaaggua  guaguugaccauagucucgg gcg  ua a
   --aguc  uua    --ua        ac                    c   uu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 8114921-8115035 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR845a
aly-MIR845aGL348719.1: 8114921-8115035 [+]
aly-MIR845bGL348719.1: 8118257-8118368 [+]
Database links

Mature sequence aly-miR845a-5p

Accession MIMAT0017631
Previous IDsaly-miR845a*
Sequence

32 - 

ucgauuggugucagagccacg

 - 52

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR845a-3p

Accession MIMAT0017632
Previous IDsaly-miR845a
Sequence

70 - 

cggcucugauaccaguugaug

 - 90

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2