Stem-loop sequence aly-MIR847

AccessionMI0014620 (change log)
DescriptionArabidopsis lyrata miR847 stem-loop
Gene family MIPF0001171; MIR847
Stem-loop
         --aag   c     u   u        a     ag      cc   -   a    a       cccccaauuaaaa 
5' gaauaa     ucu acauc uga gaagagga uggaa  ccgaga  caa auc aaac gaggcgu             u
   ||||||     ||| ||||| ||| |||||||| |||||  ||||||  ||| ||| |||| |||||||             u
3' cuuauu     aga uguag acu cuucuccu acuuu  ggcucu  guu uag uuug uucugua             g
         guuua   a     u   u        c     cu      -a   c   c    g       ucuauagugaaug 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 2579000-2579162 [+]
intergenic
Database links

Mature sequence aly-miR847-5p

Accession MIMAT0017637
Previous IDsaly-miR847*
Sequence

17 - 

ucuugaugaagaggaauggaa

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR847-3p

Accession MIMAT0017638
Previous IDsaly-miR847
Sequence

127 - 

ucacuccucuucuucaugaug

 - 147

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2