Stem-loop sequence aly-MIR856

AccessionMI0014622 (change log)
DescriptionArabidopsis lyrata miR856 stem-loop
Gene family MIPF0001162; MIR856
Stem-loop
   gca     a    --             c    auu    c      u   g    gcca       --     a  a             ga          gua  gg    u     cuua       -     auuua    u 
5'    uaugu agag  gugagacuguugg uuua   ccac aauaac uca cugc    ugaagag  uagac ga gauuauggcgguu  ggguuucuuc   ga  uuga cgauc    auguccu gugga     aguu c
      ||||| ||||  ||||||||||||| ||||   |||| |||||| ||| ||||    |||||||  ||||| || |||||||||||||  ||||||||||   ||  |||| |||||    ||||||| |||||     |||| c
3'    auaca ucuc  uauuuugacaacc aaau   ggug uuauug agu gacg    auuucuc  aucug cu cuaauaucgccga  uccgaagaag   cu  gacu gcuag    uacagga uauuu     ucaa g
   -ug     c    ac             a    -au    u      u   a    ----       ua     g  a             -g          aac  gu    u     aaca       g     ----g    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 15243159-15243439 [+]
intergenic
Database links

Mature sequence aly-miR856-5p

Accession MIMAT0017641
Previous IDsaly-miR856
Sequence

30 - 

uaauuccaccaauaacuucagc

 - 51

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR856-3p

Accession MIMAT0017642
Previous IDsaly-miR856*
Sequence

233 - 

ugauguuauuugugguauaaa

 - 253

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2