Stem-loop sequence aly-MIR859

AccessionMI0014625 (change log)
DescriptionArabidopsis lyrata miR859 stem-loop
Gene family MIPF0001191; MIR859
Stem-loop
         - -gaug    -u      a      a    c  cg                      --     ------uaa  a 
5' agucgc c     gaua  agauag ugucga aucu uc  uuguaaaaucaaacaugaguau  gaauu         cc u
   |||||| |     ||||  |||||| |||||| |||| ||  ||||||||||||||||||||||  |||||         || g
3' uuagug g     uugu  ucuauc gcagcu uaga ag  aacauuuuaguuuguacucaua  cuuag         gg a
         a acaaa    uc      c      a    u  au                      ug     uuuuuauag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 3372640-3372797 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR859
aly-MIR859GL348714.1: 3372640-3372797 [-]
aly-MIR774aGL348714.1: 3372430-3372563 [-]
aly-MIR774bGL348714.1: 3372279-3372385 [-]
Database links

Mature sequence aly-miR859-5p

Accession MIMAT0017647
Previous IDsaly-miR859
Sequence

32 - 

ucucuccguuguaaaaucaaa

 - 52

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR859-3p

Accession MIMAT0017648
Previous IDsaly-miR859*
Sequence

106 - 

ugauuuuacaauagauagaua

 - 126

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2