Stem-loop sequence aly-MIR861

AccessionMI0014627 (change log)
DescriptionArabidopsis lyrata miR861 stem-loop
Gene family MIPF0001190; MIR861
Stem-loop
        u  g        a    g      ggagucugucuucuugagaagcauu 
5' aauga gu uuuggaga auau caucau                         u
   ||||| || |||||||| |||| ||||||                          
3' uugcu ca gaacuucu uaua guagua                         u
        u  a        a    g      auaaauacucuuaauaagagugagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 13692799-13692908 [-]
intergenic
Database links

Mature sequence aly-miR861-5p

Accession MIMAT0017651
Sequence

9 - 

guuuggagaaauaugcaucau

 - 29

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR861-3p

Accession MIMAT0017652
Sequence

84 - 

gauggauauaucuucaagaac

 - 104

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2