Stem-loop sequence aly-MIR2112

AccessionMI0014632 (change log)
DescriptionArabidopsis lyrata miR2112 stem-loop
Gene family MIPF0001195; MIR2112
Stem-loop
                        c  u   a    g   aa   accaauagaggugcucagcaaaaacaacaaaau 
5' augaugcgcaaaugcggauau aa gua auca gac  caa                                 g
   ||||||||||||||||||||| || ||| |||| |||  |||                                  
3' uacuacgcguuuacgccuaua uu cau uagu cug  guu                                 c
                        u  c   a    a   gg   acaaaguuuauuacaaagacuauuugggaaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 240436-240587 [+]
intergenic
Database links

Mature sequence aly-miR2112-5p

Accession MIMAT0017661
Previous IDsaly-miR2112*
Sequence

7 - 

cgcaaaugcggauaucaaugu

 - 27

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR2112-3p

Accession MIMAT0017662
Previous IDsaly-miR2112
Sequence

128 - 

cuuuauauccgcauuugcgca

 - 148

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2