Stem-loop sequence aly-MIR395h

AccessionMI0014635 (change log)
DescriptionArabidopsis lyrata miR395h stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
        -c    c   u                    u       acuuugugaguuuguguucuaag 
5' gucaa  uguc ccu gaguucccuuaaacgcuuca uguucau                       a
   |||||  |||| ||| |||||||||||||||||||| |||||||                        
3' cgguu  acag gga cucagggggguuugugaagu acaagua                       u
        cu    u   u                    c       gucuaacuaaauagccagcuauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 14006209-14006343 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR395h
aly-MIR395dGL348714.1: 13997965-13998104 [-]
aly-MIR395eGL348714.1: 14000953-14001057 [-]
aly-MIR395fGL348714.1: 14002867-14002993 [+]
aly-MIR395gGL348714.1: 14005416-14005520 [-]
aly-MIR395hGL348714.1: 14006209-14006343 [+]
Database links

Mature sequence aly-miR395h-5p

Accession MIMAT0017667
Previous IDsaly-miR395h*
Sequence

18 - 

guucccuuaaacgcuucauug

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR395h-3p

Accession MIMAT0017668
Previous IDsaly-miR395h
Sequence

99 - 

cugaaguguuuggggggacuc

 - 119

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2