Stem-loop sequence aly-MIR402

AccessionMI0014641 (change log)
DescriptionArabidopsis lyrata miR402 stem-loop
Gene family MIPF0001123; MIR402
Stem-loop
        gca        --    u       uuuuauuucaccau     u   c    u    c          cugcuuuugaaaaguuuuccuuuuuagaaaucuucuugucucuuucucca 
5' gaguu   uaguggca  gucu cuuuugu              gaucc ugg cuau gaac ucuguuuuaa                                                  a
   |||||   ||||||||  |||| |||||||              ||||| ||| |||| |||| ||||||||||                                                  c
3' uucaa   gucaccgu  caga gaaaacg              uuagg acc gaug cuug agacaaaauu                                                  a
        -aa        au    -       --------------     c   a    c    -          uucccaaaaaccuucagucagaauuaaagaagguucuugauugcccuaca 
Get sequence
Deep sequencing
6 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 17541836-17542067 [+]
intergenic
Database links

Mature sequence aly-miR402-5p

Accession MIMAT0017681
Previous IDsaly-miR402
Sequence

48 - 

uuggccuauugaaccucuguuu

 - 69

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR402-3p

Accession MIMAT0017682
Previous IDsaly-miR402*
Sequence

181 - 

acagaguuccguagaccacgg

 - 201

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2