Stem-loop sequence aly-MIR837

AccessionMI0014644 (change log)
DescriptionArabidopsis lyrata miR837 stem-loop
Gene family MIPF0001155; MIR837
Stem-loop
            uc         u    -           u               uuu   uu 
5' uauaaaguc  cauguuuuu cauu guuucuuguuu uuucaagauuaugau   ugu  a
   |||||||||  ||||||||| |||| ||||||||||| |||||||||||||||   |||   
3' auauuucag  guacaaaaa guag caaagaacaag aaaguucuaauacua   aca  a
            ga         -    u           c               ---   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 7996708-7996826 [+]
intergenic
Database links

Mature sequence aly-miR837-5p

Accession MIMAT0017687
Sequence

22 - 

cauuguuucuuguuuuuuuca

 - 42

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR837-3p

Accession MIMAT0017688
Sequence

80 - 

aaacgaacaagaaacugauga

 - 100

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2