Stem-loop sequence aly-MIR3435

AccessionMI0014651 (change log)
DescriptionArabidopsis lyrata miR3435 stem-loop
Stem-loop
         ---aa  --      cua          ag         uc    a  gauaacua     ug       c     au           u           c   u g       guaaguugguuuggaguucaguaaagaagcagug 
5' auuuug     ca  uucauu   cugugaacag  cucaccaau  uuga cu        uucuu  acuugga ugcug  uuuggcauaau cugucaauucc uca a auguaau                                  a
   ||||||     ||  ||||||   ||||||||||  |||||||||  |||| ||        |||||  ||||||| |||||  ||||||||||| ||||||||||| ||| | |||||||                                   
3' ugaaac     gu  aaguag   gguauuuguc  gagugguua  aacu ga        gagaa  ugaacuu acggc  agaccguauua gacaguuaagg agu u uacauug                                  c
         auccg  ua      --c          cg         ga    c  -gaaguag     gu       u     --           u           a   u g       aucugauagagaccguaagguuggcaguaaauca 
Get sequence
Deep sequencing
119 reads, 3.7e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 920893-921194 [-]
intergenic
Database links

Mature sequence aly-miR3435-5p

Accession MIMAT0017701
Previous IDsaly-miR3435*
Sequence

82 - 

uggcauaauucugucaauucc

 - 102

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR3435-3p

Accession MIMAT0017702
Previous IDsaly-miR3435
Sequence

203 - 

aauugacaguauuaugccaga

 - 223

Get sequence
Deep sequencing112 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2