Stem-loop sequence aly-MIR3436

AccessionMI0014652 (change log)
DescriptionArabidopsis lyrata miR3436 stem-loop
Stem-loop
                c      g -       a               aa   uu    guu  cg 
5' aaaauuauguuuu aagcga c aaaaauc uuguugauuuugaaa  ggu  uaag   ac  g
   ||||||||||||| |||||| | ||||||| |||||||||||||||  |||  ||||   ||  u
3' uuuuaauaugaaa uuugcu g uuuuuag aacaacuagaauuuu  cua  guuu   ug  u
                a      g g       c               -c   uu    guu  uc 
Get sequence
Deep sequencing
7 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 23816604-23816732 [-]
intergenic
Database links

Mature sequence aly-miR3436-5p

Accession MIMAT0017703
Previous IDsaly-miR3436
Sequence

18 - 

cgagcaaaaaucauuguugau

 - 38

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR3436-3p

Accession MIMAT0017704
Previous IDsaly-miR3436*
Sequence

93 - 

caacaacgauuuuugggucguu

 - 114

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2