Stem-loop sequence aly-MIR3440

AccessionMI0014656 (change log)
DescriptionArabidopsis lyrata miR3440 stem-loop
Gene family MIPF0001127; MIR3440
Stem-loop
            ua   cuaa    a     a         c     g            u      c     c             uc c              g     ug        aa 
5' guuugauau  aua    cauc aaagu gauugcuug cauuu guuaggaauugg cugcgg auuuu cacaagugugguu  c uggccaauccacuu uaaug  uauuuugu  a
   |||||||||  |||    |||| ||||| ||||||||| ||||| |||||||||||| |||||| ||||| |||||||||||||  | |||||||||||||| |||||  ||||||||  u
3' cgagcuaug  ugu    guag uuuua cuaacgaac guaaa cagucuuuaacc gacgcc uaaaa guguucacgccaa  g acugguuaggugaa auuac  guaaaacg  a
            uc   -ucg    g     c         a     a            u      a     c             ga a              g     gu        ca 
Get sequence
Deep sequencing
12 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 7758213-7758454 [+]
intergenic
Database links

Mature sequence aly-miR3440-5p

Accession MIMAT0017711
Previous IDsaly-miR3440*
Sequence

80 - 

ugguuucccuggccaauccacu

 - 101

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR3440-3p

Accession MIMAT0017712
Previous IDsaly-miR3440
Sequence

145 - 

uggauuggucaagagaaccgca

 - 166

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2