Stem-loop sequence aly-MIR3443

AccessionMI0014659 (change log)
DescriptionArabidopsis lyrata miR3443 stem-loop
Stem-loop
   ----aauuu   u   ca    aacu           c   cau      aa     uc       aaa 
5'          ggc aau  gcaa    aaauucuaauc cgc   gcaccg  aaaau  uagacug   u
            ||| |||  ||||    ||||||||||| |||   ||||||  |||||  |||||||    
3'          ucg uua  uguu    uuugagauuag gug   cguggc  uuuug  gucugac   a
   uugaggaau   u   ag    cuau           a   uuc      -c     gu       aua 
Get sequence
Deep sequencing
6 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 2671734-2671868 [+]
intergenic
Database links

Mature sequence aly-miR3443-5p

Accession MIMAT0017719
Previous IDsaly-miR3443
Sequence

26 - 

uucuaaucccgccaugcaccg

 - 46

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR3443-3p

Accession MIMAT0017720
Previous IDsaly-miR3443*
Sequence

88 - 

gugccuugugagauuagaguu

 - 108

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2