Stem-loop sequence cin-mir-4046

AccessionMI0015597 (change log)
DescriptionCiona intestinalis miR-4046 stem-loop
Stem-loop
       gu  -ug         u   uauu 
5' cagg  gu   cguguuacu gug    a
   ||||  ||   ||||||||| |||    u
3' gucc  ca   gcacaauga uac    g
       ug  uaa         c   uaca 
Get sequence
Deep sequencing
874 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
13q: 2008717-2008774 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4046
cin-mir-407313q: 2009067-2009118 [-]
cin-mir-404613q: 2008717-2008774 [-]
Database links

Mature sequence cin-miR-4046-5p

Accession MIMAT0016581
Sequence

1 - 

caggguguugcguguuacuu

 - 20

Get sequence
Deep sequencing128 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4046-3p

Accession MIMAT0016582
Sequence

37 - 

ucaguaacacgaauacguccug

 - 58

Get sequence
Deep sequencing746 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1