Stem-loop sequence cin-mir-4086

AccessionMI0015639 (change log)
DescriptionCiona intestinalis miR-4086 stem-loop
Stem-loop
        u uc          a  uuuua 
5' gggag u  ccaucaaaau cu     u
   ||||| |  |||||||||| ||      
3' cccuc a  gguaguuuua ga     a
        c uc          c  uuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 864977-865032 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4086
cin-mir-40865q: 864977-865032 [-]
cin-mir-40705q: 864845-864902 [-]
cin-mir-40665q: 864513-864560 [-]
cin-mir-40855q: 863886-863941 [-]
cin-mir-40565q: 863632-863684 [-]
Database links

Mature sequence cin-miR-4086-3p

Accession MIMAT0016661
Sequence

37 - 

cauuuugauggcuaccuccc

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1