Stem-loop sequence aly-MIR4222

AccessionMI0015783 (change log)
DescriptionArabidopsis lyrata miR4222 stem-loop
Stem-loop
   --acc    cu u     aa           c    -        a  a      c       -ugauau    a     u  u 
5'      aucc  a guuga  gcgguaacaau ucga ugaaagag gg uguaga gcucaac       agga gcaau gu u
        ||||  | |||||  ||||||||||| |||| |||||||| || |||||| |||||||       |||| ||||| ||  
3'      uagg  u cgacu  cgccauuguua agcu acuuucuc cc auaucu cgaguug       uccu cguua ua u
   cuuua    uu c     cc           a    u        a  c      a       uuccacu    a     u  g 
Get sequence
Deep sequencing
16 reads, 500 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 12382831-12382996 [-]
intergenic
Database links

Mature sequence aly-miR4222

Accession MIMAT0017910
Sequence

125 - 

uuucauucgaaauuguuaccgc

 - 146

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1