Stem-loop sequence aly-MIR4223

AccessionMI0015784 (change log)
DescriptionArabidopsis lyrata miR4223 stem-loop
Stem-loop
   ---gcu    gc          u                  a       u        cagccguuuucuggug 
5'       ucuu  uuugcuugac auggaauuugauaaauaa cacaaaa auuaaacg                g
         ||||  |||||||||| |||||||||||||||||| ||||||| ||||||||                g
3'       agaa  aaacgaacug uaccuuaaacuauuuauu guguuuu uaauuugc                c
   uccaac    -a          u                  -       -        uuuuucccuuugaaac 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 24251060-24251204 [-]
intergenic
Database links

Mature sequence aly-miR4223

Accession MIMAT0017911
Sequence

21 - 

auggaauuugauaaauaaacac

 - 42

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1