Stem-loop sequence aly-MIR4225

AccessionMI0015786 (change log)
DescriptionArabidopsis lyrata miR4225 stem-loop
Stem-loop
   --ac      a         ua          -     c         u  -c      uu   gc    auc  uu 
5'     caaauc uguuuauuu  gaaucgaugg uuaaa aacacauuu ga  gacaaa  uug  gacu   ag  a
       |||||| |||||||||  |||||||||| ||||| ||||||||| ||  ||||||  |||  ||||   ||   
3'     guuuag acaaauaaa  cuuagcuacu aauuu uuguguaaa cu  cuguuu  agu  uuga   uu  u
   acca      a         uc          u     c         -  ca      uu   -a    gcu  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 25490071-25490220 [+]
intergenic
Database links

Mature sequence aly-miR4225

Accession MIMAT0017913
Sequence

21 - 

gaaucgaugguuaaacaacac

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1