Stem-loop sequence gma-MIR482b

AccessionMI0016527 (change log)
DescriptionGlycine max miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

22 open access papers mention gma-MIR482b
(51 sentences)

Stem-loop 
              -auu           uc    ag 
5' gguaugggggg    gggaaggaaua  caua  c
   |||||||||||    |||||||||||  ||||  a
3' ccauacccucc    cccuucuuuau  guau  a
              acau           -c    aa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 36454144-36454212 [+]
intergenic
Database links

Mature sequence gma-miR482b-5p

Accession MIMAT0018286
Previous IDsgma-miR482b
Sequence

3 -  

uauggggggauugggaaggaau

 - 24

Get sequence
Evidence experimental; Illumina [1,3], 454 [2]

Mature sequence gma-miR482b-3p

Accession MIMAT0020952
Sequence

48 -  

ucuucccuacaccucccauacc

 - 69

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).