Stem-loop gma-MIR394b

Accession

MI0016577

Description

Glycine max gma-MIR394b precursor miRNA

Gene family

MIPF0000100; MIR394

Literature search

9 open access papers mention gma-MIR394b
(15 sentences)

Sequence

uaacagaguuuaUUGGCAUUCUGUCCACCUCCacuuccuacucucucucugagccacauguucgugaaguuggAGGUGGGCAUACUGUCAACUgaguucuguug
((((((((((((((((((...((((((((((((((((............(((((.....))))).)))).))))))))))))...)))))).))))))))))))

Structure

            -      UUC            -    cuacucucucuc     c 
uaacagaguuua UUGGCA   UGUCCACCUCCa cuuc            ugagc a
|||||||||||| ||||||   |||||||||||| ||||            ||||| c
guugucuugagU AACUGU   ACGGGUGGAggu gaag            gcuug a
            C      CAU            u    -----------u     u 

Annotation confidence Not enough data

Genome context

chr14: 48784355-48784458 [+]

Mature gma-miR394b-3p

• Accession: MIMAT0018336
• Description: Glycine max gma-miR394b-3p mature miRNA
• Sequence: 74 - AGGUGGGCAUACUGUCAACU - 93
• Evidence: experimental ; Illumina [1-2]

Mature gma-miR394b-5p

• Accession: MIMAT0022973
• Description: Glycine max gma-miR394b-5p mature miRNA
• Sequence: 13 - UUGGCAUUCUGUCCACCUCC - 32
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553