Stem-loop sequence gma-MIR4414a

AccessionMI0016583 (change log)
DescriptionGlycine max miR4414a stem-loop
Gene family MIPF0001299; MIR4414
Literature search

1 open access papers mention gma-MIR4414a
(1 sentences)

Stem-loop 
   --      acu     g   ac       c   ag   u       aagauagauugauguucg 
5'   acugaa   cagcu cug  ucguugg ucg  agu caccauu                  g
     ||||||   ||||| |||  ||||||| |||  ||| |||||||                  c
3'   ugacuu   gucga ggc  agcaacc agu  ucg guggugg                  a
   gc      -ac     g   gu       u   cu   u       aauuaauguaccgcacuc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 36756848-36756975 [+]
intergenic
Database links

Mature sequence gma-miR4414a-5p

Accession MIMAT0018342
Previous IDsgma-miR4414
Sequence

11 -  

agcugcugacucguuggcuc

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR4414a-3p

Accession MIMAT0032112
Sequence

100 -  

uccaacgaugcgggagcugc

 - 119

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).
3
PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).