Stem-loop sequence hsa-mir-219b

Accession

MI0017299 (change log)

Symbol

HGNC:MIR219B

Description

Homo sapiens miR-219b stem-loop

Gene family

MIPF0000044; mir-219

Literature search

70 open access papers mention hsa-mir-219b
(245 sentences)

Stem-loop

     a   ca     a   -      c a       ------------   u 
5' gg gcu  gccac gau guccag c caauucu            cgg u
   || |||  ||||| ||| |||||| | |||||||            |||  
3' cc cga  cggug cua cagguu g guuaaga            gcc g
     -   ag     a   a      u c       acaugcucagac   g 

Deep sequencing

546 reads, 0 reads per million, 98 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 128392621-128392708 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000054088 ; MAPKAP1-005; intron 1

  OTTHUMT00000355310 ; MAPKAP1-017; intron 1

  OTTHUMT00000054096 ; MAPKAP1-013; intron 2

  OTTHUMT00000355307 ; MAPKAP1-014; intron 2

  OTTHUMT00000054094 ; MAPKAP1-011; intron 2

  OTTHUMT00000054092 ; MAPKAP1-009; intron 3

  OTTHUMT00000054091 ; MAPKAP1-008; intron 3

  OTTHUMT00000355308 ; MAPKAP1-015; intron 4

  OTTHUMT00000054090 ; MAPKAP1-007; intron 4

  OTTHUMT00000054086 ; MAPKAP1-003; intron 4

  ENST00000420643 ; MAPKAP1-005; intron 1

  ENST00000473837 ; MAPKAP1-017; intron 1

  ENST00000373497 ; MAPKAP1-202; intron 1

  ENST00000427078 ; MAPKAP1-013; intron 2

  ENST00000468896 ; MAPKAP1-014; intron 2

  ENST00000448439 ; MAPKAP1-011; intron 2

  ENST00000394063 ; MAPKAP1-203; intron 2

  ENST00000373498 ; MAPKAP1-009; intron 3

  ENST00000373503 ; MAPKAP1-008; intron 3

  ENST00000373511 ; MAPKAP1-015; intron 4

  ENST00000350766 ; MAPKAP1-007; intron 4

  ENST00000394060 ; MAPKAP1-003; intron 4

  ENST00000265960 ; MAPKAP1-201; intron 4

Clustered miRNAs

< 10kb from hsa-mir-219b

• hsa-mir-219a-2: chr9: 128392618-128392714 [-]
• hsa-mir-219b: chr9: 128392621-128392708 [+]

Database links

• EntrezGene:MIR2964A
• HGNC:MIR219B
• RNAcentral:URS000075EAD8_9606
• miRBase Tracker:MI0017299

Mature sequence hsa-miR-219b-5p

• Accession: MIMAT0019747
• Sequence: 14 - agauguccagccacaauucucg - 35
• Deep sequencing: 247 reads, 76 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000527B00_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-219b-5p
  • miRDB:hsa-miR-219b-5p

Mature sequence hsa-miR-219b-3p

• Accession: MIMAT0019748
• Sequence: 56 - agaauugcguuuggacaaucagu - 78
• Deep sequencing: 298 reads, 80 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000603CA3_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-219b-3p
  • miRDB:hsa-miR-219b-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).