Stem-loop sequence cin-mir-4179b

AccessionMI0019170 (change log)
DescriptionCiona intestinalis miR-4179b stem-loop
Stem-loop
   --               a  uu  ccgg  ag a   a 
5'   uuaucugguauaaaa gu  ug    au  c gac a
     ||||||||||||||| ||  ||    ||  | ||| a
3'   aguagaccauauuuu ca  ac    ua  g cug a
   cg               g  uu  ---a  aa g   a 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 6025879-6025952 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4179b
cin-mir-41124q: 6021165-6021230 [+]
cin-mir-4179b4q: 6025879-6025952 [+]
Database links

Mature sequence cin-miR-4179b-5p

Accession MIMAT0022335
Previous IDscin-miR-4179b*
Sequence

1 - 

uuaucugguauaaaaaguuuug

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence cin-miR-4179b-3p

Accession MIMAT0022336
Previous IDscin-miR-4179b
Sequence

53 - 

uuacguuuuauaccagaugagc

 - 74

Get sequence
Deep sequencing56 reads, 2 experiments
Evidence not experimental

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).