Stem-loop sequence gma-MIR5669

AccessionMI0019263 (change log)
DescriptionGlycine max miR5669 stem-loop
Stem-loop
   u       a     g   u   gua     u aga 
5'  gguguca ucaau uag gug   agugg c   g
    ||||||| ||||| ||| |||   ||||| |   u
3'  ucauagu gguua auc cac   uuauc g   u
   g       -     g   -   agg     u aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 41839111-41839181 [+]
intergenic
Database links

Mature sequence gma-miR5669

Accession MIMAT0022451
Sequence

11 - 

caauguagugugguaagugguc

 - 32

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).