Stem-loop sequence ppe-MIR6263

AccessionMI0021617 (change log)
DescriptionPrunus persica miR6263 stem-loop
Gene family MIPF0001782; MIR6263
Literature search

1 open access papers mention ppe-MIR6263
(1 sentences)

Stem-loop
   ugggauugcuuauucuaua   a            u   auag   aaag      uaa 
5'                    cuu cacucccuuuuu guu    uaa    uauuuu   a
                      ||| |||||||||||| |||    |||    ||||||    
3'                    gag gugaggggaaaa cag    auu    auaaaa   a
   -----------caacuaaa   -            -   guga   cgag      uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG2: 20351138-20351244 [+]
intergenic
Database links

Mature sequence ppe-miR6263

Accession MIMAT0027280
Sequence

77 - 

aaguggacaaaaggggagugg

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1