Stem-loop sequence sma-mir-124a

AccessionMI0021818 (change log)
Previous IDssma-mir-124
DescriptionSchistosoma mansoni miR-124a stem-loop
Literature search

4 open access papers mention sma-mir-124a
(19 sentences)

Stem-loop
   --     --   c     u     au          ----a     a     
5'   uuugu  aug cauuu ccgcg  ugccuugaug     guuau aaua 
     |||||  ||| ||||| |||||  ||||||||||     ||||| ||| u
3'   aggca  uac guaag ggcgc  acggaauuau     caaua uuau 
   cg     cc   u     u     --          aaaaa     c     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_6: 18429525-18429617 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-124a
sma-mir-124aChr_6: 18429525-18429617 [-]
sma-mir-124bChr_6: 18429504-18429647 [+]
Database links

Mature sequence sma-miR-124a-5p

Accession MIMAT0025025
Previous IDssma-miR-124-5p
Sequence

9 - 

ccauuuuccgcgauugccuugauga

 - 33

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-124a-3p

Accession MIMAT0025026
Previous IDssma-miR-124-3p
Sequence

63 - 

uaaggcacgcggugaauguca

 - 83

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).