Stem-loop sequence mmu-mir-6345

AccessionMI0021873 (change log)
Symbol MGI:Mir6345
DescriptionMus musculus miR-6345 stem-loop
Stem-loop
   -      u    --uuu  uu      gug   -    a cac  cu  g  u    -      agug 
5'  gcuuug gagu     cc  guuuca   uua gucu g   ug  ca gg gaac uaguac    u
    |||||| ||||     ||  ||||||   ||| |||| |   ||  || || |||| ||||||    g
3'  cgaaau cucg     gg  caaagu   aau cgga c   ac  gu cc cuug aucaug    u
   c      u    ucuuu  uu      --a   a    - ---  ag  a  u    g      augg 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 93352158-93352285 [+]
sense
OTTMUST00000051857 ; Ppp1r7-001; intron 5
OTTMUST00000051858 ; Ppp1r7-002; intron 5
ENSMUST00000027494 ; Ppp1r7-001; intron 5
ENSMUST00000127141 ; Ppp1r7-002; intron 5
Clustered miRNAs
< 10kb from mmu-mir-6345
mmu-mir-6902chr1: 93346092-93346155 [+]
mmu-mir-6345chr1: 93352158-93352285 [+]
Database links

Mature sequence mmu-miR-6345

Accession MIMAT0025088
Sequence

34 - 

uagcacugcucagggugaacu

 - 54

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).