Stem-loop sequence ptc-MIR6462b

AccessionMI0021981 (change log)
DescriptionPopulus trichocarpa miR6462b stem-loop
Gene family MIPF0001393; MIR6462
Literature search

1 open access papers mention ptc-MIR6462b
(2 sentences)

Stem-loop 
       a      ca                g           uguacagcgguu        gaag   a ga 
5' augg ugggau  gcgaggggcaaaaaug cauaagagaga            gggaaggg    aga a  u
   |||| ||||||  |||||||||||||||| |||||||||||            ||||||||    ||| |   
3' uacc gcucug  cgcucccuguuuuuac guauucucuuu            uccuuccc    ucu u  c
       c      ac                -           ------------        auca   a ag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 24270125-24270257 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR6462b
ptc-MIR6457bCM000341.2: 24262248-24262423 [+]
ptc-MIR6462dCM000341.2: 24265932-24266064 [+]
ptc-MIR6462eCM000341.2: 24266243-24266355 [+]
ptc-MIR6462bCM000341.2: 24270125-24270257 [+]
ptc-MIR6462fCM000341.2: 24270440-24270552 [+]
ptc-MIR6462cCM000341.2: 24280110-24280242 [+]
Database links

Mature sequence ptc-miR6462b

Accession MIMAT0025204
Sequence

96 -  

ucucuuaugcauuuuuguccc

 - 116

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2
PMID:23570526 "Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis" Shuai P, Liang D, Zhang Z, Yin W, Xia X BMC Genomics. 14:233(2013).