Stem-loop sequence mes-MIR169ac

AccessionMI0024279 (change log)
DescriptionManihot esculenta miR169ac stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169ac
(28 sentences)

Stem-loop
      u   -    -     u    u      cuc uc   c          --a     g   ---aa    ga 
5' guu gau agcc aagga gacu gccuau   c  caa aggguuucaa   cagau aau     ugca  a
   ||| ||| |||| ||||| |||| ||||||   |  ||| ||||||||||   ||||| |||     ||||   
3' cag cug ucgg uuccu cuga cggaua   g  guu ucucgagguu   gucua uua     gcgu  g
      u   a    c     -    -      cuc gu   u          uag     a   gggug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01701: 436630-436768 [+]
intergenic
Database links

Mature sequence mes-miR169ac

Accession MIMAT0029237
Sequence

7 - 

uagccaaggaugacuugccu

 - 26

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).