Stem-loop sequence mmu-mir-7647

AccessionMI0024985 (change log)
Symbol MGI:Mir7647
DescriptionMus musculus miR-7647 stem-loop
Stem-loop
   -a               c     uuuuaa 
5'   acuaccaccuccugg cuuuu      a
     ||||||||||||||| |||||       
3'   ugaugguggaggacc gaaaa      a
   ca               u     ccacga 
Get sequence
Deep sequencing
317 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 123522637-123522695 [-]
sense
OTTMUST00000063994 ; Diablo-007; intron 1
OTTMUST00000063989 ; Diablo-002; intron 2
OTTMUST00000063991 ; Diablo-004; intron 2
OTTMUST00000063988 ; Diablo-001; intron 2
OTTMUST00000063990 ; Diablo-003; intron 2
OTTMUST00000063993 ; Diablo-006; intron 2
OTTMUST00000063992 ; Diablo-005; intron 2
ENSMUST00000125047 ; Diablo-007; intron 1
ENSMUST00000125652 ; Diablo-002; intron 2
ENSMUST00000139398 ; Diablo-004; intron 2
ENSMUST00000111587 ; Diablo-001; intron 2
ENSMUST00000145152 ; Diablo-003; intron 2
ENSMUST00000111586 ; Diablo-006; intron 2
ENSMUST00000031385 ; Diablo-005; intron 2
Database links

Mature sequence mmu-miR-7647-5p

Accession MIMAT0029796
Sequence

1 - 

aacuaccaccuccuggccuuuu

 - 22

Get sequence
Deep sequencing31 reads, 19 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7647-3p

Accession MIMAT0029797
Sequence

39 - 

aaguccaggaggugguaguac

 - 59

Get sequence
Deep sequencing285 reads, 57 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1