Stem-loop sequence mmu-mir-7659

AccessionMI0024999 (change log)
Symbol MGI:Mir7659
DescriptionMus musculus miR-7659 stem-loop
Stem-loop
   -ag        -ucca        u u  c 
5'    gagccggc     gauuccug g ag u
      ||||||||     |||||||| | ||  
3'    cuuggcug     cugaggac c uc g
   gua        uucga        - -  c 
Get sequence
Deep sequencing
90 reads, 8.57 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 78340150-78340207 [-]
sense
OTTMUST00000048657 ; Agpat3-001; intron 1
OTTMUST00000048661 ; Agpat3-005; intron 2
OTTMUST00000048658 ; Agpat3-002; intron 2
OTTMUST00000048663 ; Agpat3-007; intron 2
OTTMUST00000048662 ; Agpat3-006; intron 2
ENSMUST00000001240 ; Agpat3-001; intron 1
ENSMUST00000166360 ; Agpat3-201; intron 1
ENSMUST00000105390 ; Agpat3-005; intron 2
ENSMUST00000105388 ; Agpat3-002; intron 2
ENSMUST00000138035 ; Agpat3-007; intron 2
ENSMUST00000146899 ; Agpat3-006; intron 2
Database links

Mature sequence mmu-miR-7659-5p

Accession MIMAT0029824
Sequence

1 - 

aggagccggcuccagauuccug

 - 22

Get sequence
Deep sequencing82 reads, 32 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7659-3p

Accession MIMAT0029825
Sequence

36 - 

aggagucagcuugucgguucaug

 - 58

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1