Stem-loop sequence mmu-mir-7663

AccessionMI0025003 (change log)
Symbol MGI:Mir7663
DescriptionMus musculus miR-7663 stem-loop
Stem-loop
   ---   g    g     auc      c u   a 
5'    gcu cuug ugauc   cacugu g ggg c
      ||| |||| |||||   |||||| | |||  
3'    cga gaau acuag   gugaca c uuc u
   ccu   g    -     -gu      - -   u 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 22729372-22729432 [-]
sense
OTTMUST00000069470 ; Tbpl1-001; intron 1
OTTMUST00000069471 ; Tbpl1-002; intron 1
OTTMUST00000069473 ; Tbpl1-004; intron 1
ENSMUST00000127698 ; Tbpl1-001; intron 1
ENSMUST00000095794 ; Tbpl1-002; intron 1
ENSMUST00000138022 ; Tbpl1-004; intron 1
Database links

Mature sequence mmu-miR-7663-5p

Accession MIMAT0029832
Sequence

1 - 

gcugcuuggugaucauccacugu

 - 23

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7663-3p

Accession MIMAT0029833
Sequence

40 - 

aguguggaucauaaggagcucc

 - 61

Get sequence
Deep sequencing33 reads, 16 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1