Stem-loop sequence mmu-mir-7671

AccessionMI0025011 (change log)
Symbol MGI:Mir7671
DescriptionMus musculus miR-7671 stem-loop
Stem-loop
   -a  --      u   g  a       gga 
5'   gg  cuccgc cug cu gcuuccu   a
     ||  |||||| ||| || |||||||   a
3'   cc  gaggcg gac gg cgaaggg   g
   ca  aa      -   g  -       agg 
Get sequence
Deep sequencing
200 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 53763597-53763654 [-]
intergenic
Database links

Mature sequence mmu-miR-7671-5p

Accession MIMAT0029848
Sequence

1 - 

aggcuccgcucuggcuagcuucc

 - 23

Get sequence
Deep sequencing23 reads, 17 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7671-3p

Accession MIMAT0029849
Sequence

37 - 

aagcgggcaggcggagaaccac

 - 58

Get sequence
Deep sequencing169 reads, 35 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1